Prev. |  KEGG KO K20123 > 

RIKEN DNA Bank Human Resource - PACSIN2

Gene ID NCBI Gene 11252 |  KEGG hsa:11252
Gene Symbol PACSIN2
Protein Name protein kinase C and casein kinase substrate in neurons 2
Synonyms SDPII
Ortholog resource in our bank

  PACSIN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081551 IRAL003O15 pOTB7 BC008037 NM_007229 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238512 ARiS096E16 pGCAP10 NM_007229.2  
GAGTGCTGCCGGAGCAAAAGCGGNNNCGGGAGCCCGGCCGGAGCTGGGTCTGGAGACGCC
HKR369324 RBd23F04 pGCAP10 NM_007229.2  
GGGGCAGGGCTGGGCAGTGCTGCCGGAGCAAAAGCGGTAGCGGGAGCCCGGCCGGAGCTG
HKR442333 RBdS105N21 pGCAP10 NM_007229.2  
TGTTGAGTGCTGCCGGAGCAAAAGCGGTAGCGGGAGCCCGGCCGGAGCTGGGTCTGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl