Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06123

HP ID(1) HP06123
Gene ID(2) 10113
Gene Symbol finder PREB
Protein Name prolactin regulatory element binding
RefSeq NM_013388.4
Length of RefSeq (bp) 2211
Chromosome 2p23.3
Reference DDBJ accession
UniGene Hs.279784

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi16B05 pGCAP10 GGAGACCGACTTGGACGGAGCCGAGCTGAGGCTCGGCTTCCTGCTGATGGTCAGGGTTTT
RBd01G07 pGCAP10 GGCATGCGCAGTGCGCGTCTGCGAGACCGACTTGGACGGAGCCGAGCTGAGGCTCGGCTT
RBdS156A15 pGCAP10 GGACCGACTTGGACGGAGCCGAGCTGAGGCTCGGCTTCCTGCTGATGGTCAGGGTTTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl