Prev. |  KEGG KO K14003 > 

RIKEN DNA Bank Human Resource - PREB

Gene ID NCBI Gene 10113 |  KEGG hsa:10113
Gene Symbol PREB
Protein Name prolactin regulatory element binding
Synonyms SEC12
Ortholog resources KEGG ortholog (KEGG orthology K14003) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004959 IRAK012G15 pCMV-SPORT6 BC012890 NM_013388 Full
HGX004999 IRAK012I07 pCMV-SPORT6 BC016472 NM_013388 Full
HGY097705 IRAL044E09 pOTB7 BC041032 NM_013388 Full
HGY085154 IRAL012O18 pOTB7 BC002765 NM_013388 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001783 W01A004H15 pENTR-TOPO IRAK012I07 BC016472 NM_013388  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166429 ARi16B05 pGCAP10 NM_013388.4  
GGAGACCGACTTGGACGGAGCCGAGCTGAGGCTCGGCTTCCTGCTGATGGTCAGGGTTTT
HKR360551 RBd01G07 pGCAP10 NM_013388.4  
GGCATGCGCAGTGCGCGTCTGCGAGACCGACTTGGACGGAGCCGAGCTGAGGCTCGGCTT
HKR462415 RBdS156A15 pGCAP10 NM_013388.4  
GGACCGACTTGGACGGAGCCGAGCTGAGGCTCGGCTTCCTGCTGATGGTCAGGGTTTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl