Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06121

HP ID(1) HP06121
Gene ID(2) 9367
Gene Symbol finder RAB9A
Protein Name RAB9A, member RAS oncogene family
RefSeq NM_004251.3
Length of RefSeq (bp) 1097
Chromosome Xp22.2
Reference DDBJ accession
UniGene Hs.495704

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi20E04 pGCAP10 ATGTTGTTCCCTCCGCGCTGGACGGGAGCAGCTGGAGCGGGAGCCTGGCTGCGCTACCGC
ARi58F09 pGCAP10 GCCCTCCGCGCTGGACGGGAGCAGCTGGAGCGGGAGCCTGGCTGCGCTACCGCGGCTGCC
ARiS109E20 pGCAP10 GGCTACCGCGGCTGCCTCCTGCTGTGCAGGTCCCCGACCCTCTCTCTGTCCTCATTGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl