Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06104

HP ID(1) HP06104
Gene ID(2) 5331
Gene Symbol finder PLCB3
Protein Name phospholipase C, beta 3 (phosphatidylinositol-specific)
RefSeq NM_000932.1
Length of RefSeq (bp) 3705
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.591953

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi44E06 pGCAP10 GGCGGGCGGGCGGGCACTGACGCCGCGGGGCCGGAGCGGGCCGCGCGGTGGGAGCAGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl