Prev. |  KEGG KO K05858 > 

RIKEN DNA Bank Human Resource - PLCB3

Gene ID NCBI Gene 5331 |  KEGG hsa:5331
Gene Symbol PLCB3
Protein Name phospholipase C beta 3
Synonyms -
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  PLCB3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027831 IRAK069J15 pCMV-SPORT6 BC032659 NM_000932 Full/var
HGY097673 IRAL044D01 pOTB7 BC041625 NM_000932 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177702 ARi44E06 pGCAP10 NM_000932.1  
GGCGGGCGGGCGGGCACTGACGCCGCGGGGCCGGAGCGGGCCGCGCGGTGGGAGCAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl