Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06077

HP ID(1) HP06077
Gene ID(2) 83540
Gene Symbol finder NUF2
Protein Name NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)
RefSeq NM_031423.3
Length of RefSeq (bp) 1843
Chromosome 1q23.3
Reference DDBJ accession
UniGene Hs.651950

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi32C10 pGCAP10 GGCGAGAGGACGGAGGAAGGAAGCCTGCAGACAGACGCCTTCTCCATCCCAAGGCGCGGG
ARi57G04 pGCAP10 GCTGTCGGCGGCCGGCACTGTAGGTGAGCGCGAGAGGACGGAGGAAGGAAGCCTGCAGAC
RBd87C07 pGCAP10 GGATTTTTGACTTTGCTTGTAGCTGCTCCCCGAACTCGCCGTCTTCCTGTCGGCGGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl