Prev. |  KEGG KO K11548 > 

RIKEN DNA Bank Human Resource - NUF2

Gene ID NCBI Gene 83540 |  KEGG hsa:83540
Gene Symbol NUF2
Protein Name NUF2 component of NDC80 kinetochore complex
Synonyms CDCA1|CT106|NUF2R
Ortholog resource in our bank

  NUF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088685 IRAL021L21 pDNR-LIB BC008489 NM_145697 Full/var
HGY092517 IRAL031E21 pDNR-LIB BC021171 NM_145697 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172858 ARi32C10 pGCAP10 NM_031423.3  
GGCGAGAGGACGGAGGAAGGAAGCCTGCAGACAGACGCCTTCTCCATCCCAAGGCGCGGG
HKR182948 ARi57G04 pGCAP10 NM_031423.3  
GCTGTCGGCGGCCGGCACTGTAGGTGAGCGCGAGAGGACGGAGGAAGGAAGCCTGCAGAC
HKR394855 RBd87C07 pGCAP10 NM_031423.3  
GGATTTTTGACTTTGCTTGTAGCTGCTCCCCGAACTCGCCGTCTTCCTGTCGGCGGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl