Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUF2

Gene ID (NCBI) 83540
Gene Symbol NUF2
Protein Name NUF2, NDC80 kinetochore complex component
Synonyms CDCA1|CT106|NUF2R
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11548)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY088685 IRAL021L21 pDNR-LIB BC008489 NM_145697 Full/var
HGY092517 IRAL031E21 pDNR-LIB BC021171 NM_145697 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172858 ARi32C10 pGCAP10 NM_031423.3  
GGCGAGAGGACGGAGGAAGGAAGCCTGCAGACAGACGCCTTCTCCATCCCAAGGCGCGGG
HKR182948 ARi57G04 pGCAP10 NM_031423.3  
GCTGTCGGCGGCCGGCACTGTAGGTGAGCGCGAGAGGACGGAGGAAGGAAGCCTGCAGAC
HKR394855 RBd87C07 pGCAP10 NM_031423.3  
GGATTTTTGACTTTGCTTGTAGCTGCTCCCCGAACTCGCCGTCTTCCTGTCGGCGGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl