Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06050

HP ID(1) HP06050
Gene ID(2) 5884
Gene Symbol finder RAD17
Protein Name RAD17 homolog (S. pombe)
RefSeq NM_133340.1
Length of RefSeq (bp) 2666
Chromosome 5q13
Reference DDBJ accession
UniGene Hs.16184

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd90A09 pGCAP10 GGGGAGGCCGTACCTCCGAGAGGCTCGGCGTTGAGCCCGGGTAGGGCCAGGTGGCTGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl