Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06035

HP ID(1) HP06035
Gene ID(2) 196463
Gene Symbol finder PLBD2
Protein Name phospholipase B domain containing 2
RefSeq NM_173542.3
Length of RefSeq (bp) 2832
Chromosome 12q24.13
Reference DDBJ accession
UniGene Hs.115896

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb38B02 pGCAP1 GATTGTGCGGTCATGGTGGGCCAGATGTACTGCTACCCCGGCAGCCACCTGGCCCGGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl