Prev. | 

RIKEN DNA Bank Human Resource - PLBD2

Gene ID NCBI Gene 196463 |  KEGG hsa:196463
Gene Symbol PLBD2
Protein Name phospholipase B domain containing 2
Synonyms P76
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018625 IRAK046J09 pBluescriptR BC030618 NM_173542

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE089633 M01C024B09 pDONR221 MGC01-G05 BC030618 ENST00000280800  
HGE089681 M01C024D09 pDONR221 MGC01-G05 BC030618 ENST00000280800  
HGE089729 M01C024F09 pDONR221 MGC01-G05 BC030618 ENST00000280800  
HGE089777 M01C024H09 pDONR221 MGC01-G05 BC030618 ENST00000280800  
HGE089825 M01C024J09 pDONR221 MGC01-G05 BC030618 ENST00000280800  
HGE089873 M01C024L09 pDONR221 MGC01-G05 BC030618 ENST00000280800  
HGE089921 M01C024N09 pDONR221 MGC01-G05 BC030618 ENST00000280800  
HGE089969 M01C024P09 pDONR221 MGC01-G05 BC030618 ENST00000280800  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR335226 RBb38B02 pGCAP1 NM_173542.3  
GATTGTGCGGTCATGGTGGGCCAGATGTACTGCTACCCCGGCAGCCACCTGGCCCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl