Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06034

HP ID(1) HP06034
Gene ID(2) 55009
Gene Symbol finder C19orf24
Protein Name chromosome 19 open reading frame 24
RefSeq NM_017914.3
Length of RefSeq (bp) 912
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.591383

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf06A01 pKA1U5 GGCACCGCTTCCGCCGGGCCATGGGGCCGCGCCNGTTTNAAGCCGCCGCTGCTGCTGCTC
ARi10E10 pGCAP10 GACTGAAGCCGGAGCATGCCGGGCAGGGGTCAGGCCCTGGCGGGGCGAGGGGGCCTCCTT
RBb37H09 pGCAP1 GCGCTTCCGCCGGGCCATGGGGCCGCGCGTGCTGCAGCCGCCGCTGCTGCTGCTCCTGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl