Prev. | 

RIKEN DNA Bank Human Resource - C19orf24

Gene ID NCBI Gene 55009 |  KEGG hsa:55009
Gene Symbol C19orf24
Protein Name chromosome 19 open reading frame 24
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001692 IRAK004D20 pCMV-SPORT6 BC000890 NM_017914

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082401 ARf06A01 pKA1U5 NM_017914.3  
GGCACCGCTTCCGCCGGGCCATGGGGCCGCGCCNGTTTNAAGCCGCCGCTGCTGCTGCTC
HKR164106 ARi10E10 pGCAP10 NM_017914.3  
GACTGAAGCCGGAGCATGCCGGGCAGGGGTCAGGCCCTGGCGGGGCGAGGGGGCCTCCTT
HKR334977 RBb37H09 pGCAP1 NM_017914.3  
GCGCTTCCGCCGGGCCATGGGGCCGCGCGTGCTGCAGCCGCCGCTGCTGCTGCTCCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl