Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06033

HP ID(1) HP06033
Gene ID(2) 8153
Gene Symbol finder RND2
Protein Name Rho family GTPase 2
RefSeq NM_005440.4
Length of RefSeq (bp) 4169
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.603111

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb37G08 pGCAP1 GCAAAGGCNNCNGGGCCGNGTTATNTCCCCNTCNGTGANGTGATAAACTGACATCNACGA
RBdS013I05 pGCAP10 GAGGGGCCCTGGCGACGGATGGGAATGGAGTTATGTCCCCACCGTGTTTGAGAACTACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl