Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06021

HP ID(1) HP06021
Gene ID(2) 65095
Gene Symbol finder KRI1
Protein Name KRI1 homolog (S. cerevisiae)
RefSeq NM_023008.3
Length of RefSeq (bp) 3023
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.709967

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb36B10 pGCAP1 GGGGCCACAGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGG
RBd93G02 pGCAP10 GAGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGGCGTTTGC
RBdS081B13 pGCAP10 GAGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGGCGTTTGC
RBdS154H03 pGCAP10 GGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGGCGTTTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl