Prev. |  KEGG KO K14786 > 

RIKEN DNA Bank Human Resource - KRI1

Gene ID NCBI Gene 65095 |  KEGG hsa:65095
Gene Symbol KRI1
Protein Name KRI1 homolog
Synonyms -
Ortholog resource in our bank

  KRI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086205 IRAL015I13 pOTB7 BC002890 NM_178159 Full/var
HGY090205 IRAL025I13 pOTB7 BC009876 NM_178159 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR334434 RBb36B10 pGCAP1 NM_023008.3  
GGGGCCACAGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGG
HKR397346 RBd93G02 pGCAP10 NM_023008.3  
GAGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGGCGTTTGC
HKR432437 RBdS081B13 pGCAP10 NM_023008.3  
GAGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGGCGTTTGC
HKR461771 RBdS154H03 pGCAP10 NM_023008.3  
GGAGCCGCCATGCCGGAACCGCGCGGGTCGTCGCAGCTGCGGGTGAACGCGGCGTTTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl