Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05999

HP ID(1) HP05999
Gene ID(2) 9274
Gene Symbol finder BCL7C
Protein Name B-cell CLL/lymphoma 7C
RefSeq NM_004765.2
Length of RefSeq (bp) 877
Chromosome 16p11
Reference DDBJ accession
UniGene Hs.658547

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb34C02 pGCAP1
RBdS014N05 pGCAP10 GGGGGGGGACGGCAGGCCGAGAGCGCGGCGCCCGGGCCTGGCGCGGAGCCTGAGCCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl