Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014N05

Clone ID RBdS014N05
HP ID HP05999
Gene ID 9274
Gene Symbol BCL7C
Protein Name B-cell CLL/lymphoma 7C
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004765.2
Length of RefSeq (bp) 877
Chromosome 16p11
Reference DDBJ accession
UniGene Hs.658547
5'-terminal sequence GGGGGGGGACGGCAGGCCGAGAGCGCGGCGCCCGGGCCTGGCGCGGAGCCTGAGCCCGCC
2011.08.28