Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05998

HP ID(1) HP05998
Gene ID(2) 54913
Gene Symbol finder RPP25
Protein Name ribonuclease P/MRP 25kDa subunit
RefSeq NM_017793.2
Length of RefSeq (bp) 2333
Chromosome 15q24.2
Reference DDBJ accession
UniGene Hs.8562

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb34A08 pGCAP1 GAGAGCGGCGCCCGCTCGAGAGAAGTGGGGCCGAGATCGCGCCNTTCCCAGCCCGCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl