Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05988

HP ID(1) HP05988
Gene ID(2) 8570
Gene Symbol finder KHSRP
Protein Name KH-type splicing regulatory protein
RefSeq NM_003685.2
Length of RefSeq (bp) 3262
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.723206

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe78G10 pKA1U5 GAGAGTGCTCCGCGGCCGCTGTTGGAGCGAGGCCTTGNTTCCCGCGATTGAGCCGCCGCC
RBd28E09 pGCAP10 GGAGTGCTCCGCGGCCGTGTGGAGCGAGGCCTTGTTCCCGCGTTGAGCCGCCGCCGCCGC
RBd44H08 pGCAP10 GGCCTTGTTCCCGCGTTGAGCCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCAGCCTCCGC
RBdS105A23 pGCAP10 GGGAGCGAGGCCTTGTTCCCGCGTTGAGCCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCA
RBdS177G13 pGCAP10 GCCCAGAGTGCTCCNCNNNCGTGTGGAGCNAGGCCTTGTNCCCGCGTTGAGCCGCCGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl