Prev. |  KEGG KO K13210 > 

RIKEN DNA Bank Human Resource - KHSRP

Gene ID NCBI Gene 8570 |  KEGG hsa:8570
Gene Symbol KHSRP
Protein Name KH-type splicing regulatory protein
Synonyms FBP2|FUBP2|KSRP
Ortholog resources KEGG ortholog (KEGG orthology K13210) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103949 IRAL059O13 pOTB7 BC085004 NM_003685 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071354 ARe78G10 pKA1U5 NM_003685.2  
GAGAGTGCTCCGCGGCCGCTGTTGGAGCGAGGCCTTGNTTCCCGCGATTGAGCCGCCGCC
HKR371305 RBd28E09 pGCAP10 NM_003685.2  
GGAGTGCTCCGCGGCCGTGTGGAGCGAGGCCTTGTTCCCGCGTTGAGCCGCCGCCGCCGC
HKR377776 RBd44H08 pGCAP10 NM_003685.2  
GGCCTTGTTCCCGCGTTGAGCCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCAGCCTCCGC
HKR442023 RBdS105A23 pGCAP10 NM_003685.2  
GGGAGCGAGGCCTTGTTCCCGCGTTGAGCCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCA
HKR470957 RBdS177G13 pGCAP10 NM_003685.2  
GCCCAGAGTGCTCCNCNNNCGTGTGGAGCNAGGCCTTGTNCCCGCGTTGAGCCGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl