Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05977

HP ID(1) HP05977
Gene ID(2) 9136
Gene Symbol finder RRP9
Protein Name ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)
RefSeq NM_004704.3
Length of RefSeq (bp) 1588
Chromosome 3p21.1
Reference DDBJ accession
UniGene Hs.153768

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS051O07 pGCAP10 GGGGGAGCTGGGAGGGTTCAGCTGCCACGTGAGTTCTGCGGCCGCTGCTACACGCCTGGT
RBdS187P03 pGCAP10 GAGGCGGCTGGGGAGCTGGGAGGGTTCAGCTGCCACGTGAGTTCTGCGGCCGCTGCTACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl