Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05975

HP ID(1) HP05975
Gene ID(2) 8816
Gene Symbol finder WDR22
Protein Name WD repeat domain 22
RefSeq NM_003861.2
Length of RefSeq (bp) 5999
Chromosome 14q23-q24.1
Reference DDBJ accession
UniGene Hs.509780

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd66E10 pGCAP10 GGCGGCGGCGGCGGCGGTTCCAGCATGAAGAGGAGAGCTGGCCTGGGGGGCAGCATGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl