Prev. |  KEGG KO K11800 > 

RIKEN DNA Bank Human Resource - DCAF5

Gene ID NCBI Gene 8816 |  KEGG hsa:8816
Gene Symbol DCAF5
Protein Name DDB1 and CUL4 associated factor 5
Synonyms BCRG2|BCRP2|D14S1461E|WDR22
Ortholog resource in our bank

  DCAF5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017101 IRAK042M13 pCMV-SPORT6 BC022967 NM_003861 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092816 M01C032A16 pDONR221 MGC05-F08 BC022967 NM_003861  
HGE092864 M01C032C16 pDONR221 MGC05-F08 BC022967 NM_003861  
HGE092912 M01C032E16 pDONR221 MGC05-F08 BC022967 NM_003861  
HGE092960 M01C032G16 pDONR221 MGC05-F08 BC022967 NM_003861  
HGE093008 M01C032I16 pDONR221 MGC05-F08 BC022967 NM_003861  
HGE093056 M01C032K16 pDONR221 MGC05-F08 BC022967 NM_003861  
HGE093104 M01C032M16 pDONR221 MGC05-F08 BC022967 NM_003861  
HGE093152 M01C032O16 pDONR221 MGC05-F08 BC022967 NM_003861  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386506 RBd66E10 pGCAP10 NM_003861.2  
GGCGGCGGCGGCGGCGGTTCCAGCATGAAGAGGAGAGCTGGCCTGGGGGGCAGCATGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl