Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05972

HP ID(1) HP05972
Gene ID(2) 9682
Gene Symbol finder JMJD2A
Protein Name jumonji domain containing 2A
RefSeq NM_014663.2
Length of RefSeq (bp) 4526
Chromosome 1p34.1
Reference DDBJ accession
UniGene Hs.155983

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe96G06 pKA1U5 ATCCTGGGCGCAGATGCCGACTTTAGAGGAGGCGGAGTTTCGGCCTTCGCCTGCTGGAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl