Prev. |  KEGG KO K06709 > 

RIKEN DNA Bank Human Resource - KDM4A

Gene ID NCBI Gene 9682 |  KEGG hsa:9682
Gene Symbol KDM4A
Protein Name lysine demethylase 4A
Synonyms JHDM3A|JMJD2|JMJD2A|TDRD14A
Ortholog resources KEGG ortholog (KEGG orthology K06709) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081883 IRAL004L19 pOTB7 BC002558 NM_014663 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024089 W01A060D17 pENTR-TOPO IRAL004L19 BC002558 NM_014663  
HGE024093 W01A060D21 pENTR-TOPO IRAL004L19 BC002558 NM_014663  
HGE024095 W01A060D23 pENTR-TOPO IRAL004L19 BC002558 NM_014663  
HGE033349 W01A083G05 pENTR-TOPO IRAL004L19 BC002558 NM_014663  
HGE033351 W01A083G07 pENTR-TOPO IRAL004L19 BC002558 NM_014663  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078550 ARe96G06 pKA1U5 NM_014663.2  
ATCCTGGGCGCAGATGCCGACTTTAGAGGAGGCGGAGTTTCGGCCTTCGCCTGCTGGAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl