Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05965

HP ID(1) HP05965
Gene ID(2) 4925
Gene Symbol finder NUCB2
Protein Name nucleobindin 2
RefSeq NM_005013.2
Length of RefSeq (bp) 1612
Chromosome 11p15.1-p14
Reference DDBJ accession
UniGene Hs.654599

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi69F06 pGCAP10 GAGAGCGGAGCGGTGGGCCGGGGGCTGGAGGACAGGTTTGTGCGCTGGACGCAAGCACCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl