Prev. |  KEGG KO K20371 > 

RIKEN DNA Bank Human Resource - NUCB2

Gene ID NCBI Gene 4925 |  KEGG hsa:4925
Gene Symbol NUCB2
Protein Name nucleobindin 2
Synonyms HEL-S-109|NEFA
Ortholog resource in our bank

  NUCB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187726 ARi69F06 pGCAP10 NM_005013.2  
GAGAGCGGAGCGGTGGGCCGGGGGCTGGAGGACAGGTTTGTGCGCTGGACGCAAGCACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl