Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUCB2

Gene ID (NCBI) 4925
Gene Symbol NUCB2
Protein Name nucleobindin 2
Synonyms HEL-S-109|NEFA
Databases KEGG hsa:4925 |  NCBI Gene 4925
Featured content Ortholog resources in the DNA Bank (KEGG orthology K20371)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR187726 ARi69F06 pGCAP10 NM_005013.2  
GAGAGCGGAGCGGTGGGCCGGGGGCTGGAGGACAGGTTTGTGCGCTGGACGCAAGCACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl