Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05963

HP ID(1) HP05963
Gene ID(2) 4836
Gene Symbol finder NMT1
Protein Name N-myristoyltransferase 1
RefSeq NM_021079.3
Length of RefSeq (bp) 4903
Chromosome 17q21.31
Reference DDBJ accession
UniGene Hs.532790

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096I24 pGCAP10 GGGAGCCCTGCTCTCGCAACTCAAGATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCC
RBb56G04 pGCAP1 GGCAACTCAAGATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCTCCGCTGC
RBb58G12 pGCAP1 GGTCCATAGGAACCCCCCATGTAGTGGGGCGCGGAGCCCTGCTCTCGCAACTCAAGATGG
RBd85H02 pGCAP10 GATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCTCCGCTGCCGCAGATGAT
RBdS040L09 pGCAP10 AAAGTCTCGCAACTCAAGATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl