Prev. |  KEGG KO K00671 > 

RIKEN DNA Bank Human Resource - NMT1

Gene ID NCBI Gene 4836 |  KEGG hsa:4836
Gene Symbol NMT1
Protein Name N-myristoyltransferase 1
Synonyms NMT
Ortholog resource in our bank

  NMT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004975 IRAK012H07 pCMV-SPORT6 BC008579 NM_021079 Partial
HGY081556 IRAL003O20 pOTB7 BC006538 NM_021079 Full
HGY084300 IRAL010M12 pOTB7 BC006569 NM_021079
HGY088950 IRAL022G06 pOTB7 BC008312 NM_021079 Partial
HGY088951 IRAL022G07 pOTB7 BC007258 NM_021079 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238616 ARiS096I24 pGCAP10 NM_021079.3  
GGGAGCCCTGCTCTCGCAACTCAAGATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCC
HKR342548 RBb56G04 pGCAP1 NM_021079.3  
GGCAACTCAAGATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCTCCGCTGC
HKR343356 RBb58G12 pGCAP1 NM_021079.3  
GGTCCATAGGAACCCCCCATGTAGTGGGGCGCGGAGCCCTGCTCTCGCAACTCAAGATGG
HKR394170 RBd85H02 pGCAP10 NM_021079.3  
GATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCTCCGCTGCCGCAGATGAT
HKR416273 RBdS040L09 pGCAP10 NM_021079.3  
AAAGTCTCGCAACTCAAGATGGCGGACGAGAGTGAGACAGCAGTGAAGCCGCCGGCACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl