Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05957

HP ID(1) HP05957
Gene ID(2) 10629
Gene Symbol finder TAF6L
Protein Name TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa
RefSeq NM_006473.2
Length of RefSeq (bp) 2016
Chromosome 11q12.3
Reference DDBJ accession
UniGene Hs.714400

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd52A07 pGCAP10 GACCGCCCCCGCCGCCGTCGTCTCGGTAGCAGCCTTCGCCACGCCGGGGTCTTCAGCTCC
RBdS110F16 pGCAP10 GGGGGCCCCGGGAGAGGGAATGAGTGTGAGCTCGTGAGTGGGCGCCGCCGCCACCGCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl