Prev. |  KEGG KO K03131 > 

RIKEN DNA Bank Human Resource - TAF6L

Gene ID NCBI Gene 10629 |  KEGG hsa:10629
Gene Symbol TAF6L
Protein Name TATA-box binding protein associated factor 6 like
Synonyms PAF65A
Ortholog resource in our bank

  TAF6L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085002 IRAL012I10 pOTB7 BC008785 NM_006473 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380807 RBd52A07 pGCAP10 NM_006473.2  
GACCGCCCCCGCCGCCGTCGTCTCGGTAGCAGCCTTCGCCACGCCGGGGTCTTCAGCTCC
HKR444136 RBdS110F16 pGCAP10 NM_006473.2  
GGGGGCCCCGGGAGAGGGAATGAGTGTGAGCTCGTGAGTGGGCGCCGCCGCCACCGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl