Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05940

HP ID(1) HP05940
Gene ID(2) 10622
Gene Symbol finder POLR3G
Protein Name polymerase (RNA) III (DNA directed) polypeptide G (32kD)
RefSeq NM_006467.2
Length of RefSeq (bp) 3285
Chromosome 5q14.3
Reference DDBJ accession
UniGene Hs.282387

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096M09 pGCAP10 GCTTTCCTTGCCGGCCGGCACTTCGGCTGCAGAGTTTTGCCCACGCTTCGAGACTTAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl