Prev. |  KEGG KO K03024 > 

RIKEN DNA Bank Human Resource - POLR3G

Gene ID NCBI Gene 10622 |  KEGG hsa:10622
Gene Symbol POLR3G
Protein Name RNA polymerase III subunit G
Synonyms RPC32|RPC7
Ortholog resources KEGG ortholog (KEGG orthology K03024) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238697 ARiS096M09 pGCAP10 NM_006467.2  
GCTTTCCTTGCCGGCCGGCACTTCGGCTGCAGAGTTTTGCCCACGCTTCGAGACTTAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl