Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05917

HP ID(1) HP05917
Gene ID(2) 51029
Gene Symbol finder PPPDE1
Protein Name PPPDE peptidase domain containing 1
RefSeq NM_016076.3
Length of RefSeq (bp) 4093
Chromosome 1q44
Reference DDBJ accession
UniGene Hs.498317

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb65F03 pGCAP1 AAAATCAAAGGTATGAAACTTGAAGAATGGGTAGCATCCACAAGGACAGAGAACAATTGA
RBd60B06 pGCAP10 GAGGGGAGGTGCCTCATCCGGAGCGGGCCGCCAACGGTCCGGCCCCGTCCGCACAGACGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl