Prev. | 

RIKEN DNA Bank Human Resource - DESI2

Gene ID NCBI Gene 51029 |  KEGG hsa:51029
Gene Symbol DESI2
Protein Name desumoylating isopeptidase 2
Synonyms C1orf121|CGI-146|DESI|DESI1|DeSI-2|FAM152A|PNAS-4|PPPDE1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029951 IRAK074O15 pBluescriptR BC040608 NM_016076
HGY085633 IRAL014B09 pOTB7 BC004485 NM_016076 Full
HGY094915 IRAL037E19 pDNR-LIB BC020640 NM_016076 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR346123 RBb65F03 pGCAP1 NM_016076.3  
AAAATCAAAGGTATGAAACTTGAAGAATGGGTAGCATCCACAAGGACAGAGAACAATTGA
HKR384030 RBd60B06 pGCAP10 NM_016076.3  
GAGGGGAGGTGCCTCATCCGGAGCGGGCCGCCAACGGTCCGGCCCCGTCCGCACAGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl