Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05905

HP ID(1) HP05905
Gene ID(2) 84300
Gene Symbol finder C6orf125
Protein Name chromosome 6 open reading frame 125
RefSeq NM_032340.2
Length of RefSeq (bp) 535
Chromosome 6p21.31
Reference DDBJ accession
UniGene Hs.93235

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150M20 pGCAP10 GGGGGCCCAAGATGGCGGCCAGCCGGTACCGGCGTTTTCTTAAGCTCTGTGAGGAATGGC
RBd14C09 pGCAP10 GGGGGCCCAAGATGGCGGCCAGCCGGTACCGGCGTTTTCTTAAGCTCTGTGAGGAATGGC
RBd78B02 pGCAP10 GGGGGCCCAAGATGGCGGCCAGCCGGTACCGGCGTTTTCTTAAGCTCTGTGAGGAATGGC
RBdS156N18 pGCAP10 CGGCCGGNCNGCCGGNCCCGGCGTTTTCTTAAGCTCTGTGAGGAATGGCCNGTGGACCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl