Prev. |  KEGG KO K17682 > 

RIKEN DNA Bank Human Resource - UQCC2

Gene ID NCBI Gene 84300 |  KEGG hsa:84300
Gene Symbol UQCC2
Protein Name ubiquinol-cytochrome c reductase complex assembly factor 2
Synonyms C6orf125|C6orf126|Cbp6|M19|MC3DN7|MNF1|bA6B20.2
Ortholog resource in our bank

  UQCC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088432 IRAL021B08 pDNR-LIB BC006007 NM_032340 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260308 ARiS150M20 pGCAP10 NM_032340.2  
GGGGGCCCAAGATGGCGGCCAGCCGGTACCGGCGTTTTCTTAAGCTCTGTGAGGAATGGC
HKR365657 RBd14C09 pGCAP10 NM_032340.2  
GGGGGCCCAAGATGGCGGCCAGCCGGTACCGGCGTTTTCTTAAGCTCTGTGAGGAATGGC
HKR391226 RBd78B02 pGCAP10 NM_032340.2  
GGGGGCCCAAGATGGCGGCCAGCCGGTACCGGCGTTTTCTTAAGCTCTGTGAGGAATGGC
HKR462730 RBdS156N18 pGCAP10 NM_032340.2  
CGGCCGGNCNGCCGGNCCCGGCGTTTTCTTAAGCTCTGTGAGGAATGGCCNGTGGACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl