Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05898

HP ID(1) HP05898
Gene ID(2) 9894
Gene Symbol finder TELO2
Protein Name TEL2, telomere maintenance 2, homolog (S. cerevisiae)
RefSeq NM_016111.2
Length of RefSeq (bp) 3319
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.271044

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi13D04 pGCAP10 AGGAACTCGTGCTCGGGGCCAACCGGCTGGGCCGCGATCGCGTTTCGTCCGGGGCCGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl