DNA Bank Top |  KEGG KO K11137 > 

RIKEN DNA Bank Human Resource - TELO2

Gene ID NCBI Gene 9894 |  KEGG hsa:9894
Gene Symbol TELO2
Protein Name telomere maintenance 2
Synonyms CLK2|TEL2|YHFS

Link

Ortholog resource in our bank

  TELO2

External database

human TELO2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19795 p3xFLAG-CMV10-hTel2 Transient expression vector of human Tel2 with N-terminal 3×FLAG.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081612 IRAL004A12 pOTB7 BC017188 NM_016111 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081603 M01C004A03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE081651 M01C004C03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE081699 M01C004E03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE081747 M01C004G03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE081795 M01C004I03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE081843 M01C004K03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE081891 M01C004M03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE081939 M01C004O03 pDONR221 04-134-2_2-E02 BC017188 ENST00000262319  
HGE100008 M01C050A08 pDONR221 MGC14-F04 BC017188 ENST00000262319  
HGE100056 M01C050C08 pDONR221 MGC14-F04 BC017188 ENST00000262319  
HGE100104 M01C050E08 pDONR221 MGC14-F04 BC017188 ENST00000262319  
HGE100152 M01C050G08 pDONR221 MGC14-F04 BC017188 ENST00000262319  
HGE100200 M01C050I08 pDONR221 MGC14-F04 BC017188 ENST00000262319  
HGE100248 M01C050K08 pDONR221 MGC14-F04 BC017188 ENST00000262319  
HGE100296 M01C050M08 pDONR221 MGC14-F04 BC017188 ENST00000262319  
HGE100344 M01C050O08 pDONR221 MGC14-F04 BC017188 ENST00000262319  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165276 ARi13D04 pGCAP10 NM_016111.2  
AGGAACTCGTGCTCGGGGCCAACCGGCTGGGCCGCGATCGCGTTTCGTCCGGGGCCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl