Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05859

HP ID(1) HP05859
Gene ID(2) 79042
Gene Symbol finder TSEN34
Protein Name tRNA splicing endonuclease 34 homolog (S. cerevisiae)
RefSeq NM_024075.2
Length of RefSeq (bp) 1368
Chromosome 19q13.4
Reference DDBJ accession
UniGene Hs.15580

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe92H09 pKA1U5 GGAGGCCTAGGGGCGGGGCTTCGCCGAGACCCCGGAGGCTTTGGGTGCGCTGCAGCGGTC
RBb27H11 pGCAP1 GCCAGCGCGCCCCCGCGCCGCCTGCTCCTTCTGGGCGCCCGCCGGGCTGCGCAGATCAGG
RBd94H05 pGCAP10 GAGGCTTTGGGTGCGCTGCAGCGGTCCGCGGCGCGCAGCTGTTTCGGTAACTGCTTTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl