Prev. |  KEGG KO K15323 > 

RIKEN DNA Bank Human Resource - TSEN34

Gene ID NCBI Gene 79042 |  KEGG hsa:79042
Gene Symbol TSEN34
Protein Name tRNA splicing endonuclease subunit 34
Synonyms LENG5|PCH2C|SEN34|SEN34L
Ortholog resource in our bank

  TSEN34

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001492 IRAK003M04 pCMV-SPORT6 BC000944 NM_024075 Full
HGY082025 IRAL005B01 pOTB7 BC004530 NM_024075 Full/var
HGY094242 IRAL035K02 pDNR-LIB BC020805 NM_024075 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006450 W01A016C02 pENTR-TOPO IRAK003M04 BC000944 NM_024075  
HGE006452 W01A016C04 pENTR-TOPO IRAK003M04 BC000944 NM_024075  
HGE006456 W01A016C08 pENTR-TOPO IRAK003M04 BC000944 NM_024075  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076977 ARe92H09 pKA1U5 NM_024075.2  
GGAGGCCTAGGGGCGGGGCTTCGCCGAGACCCCGGAGGCTTTGGGTGCGCTGCAGCGGTC
HKR330979 RBb27H11 pGCAP1 NM_024075.2  
GCCAGCGCGCCCCCGCGCCGCCTGCTCCTTCTGGGCGCCCGCCGGGCTGCGCAGATCAGG
HKR397773 RBd94H05 pGCAP10 NM_024075.2  
GAGGCTTTGGGTGCGCTGCAGCGGTCCGCGGCGCGCAGCTGTTTCGGTAACTGCTTTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl