Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05850

HP ID(1) HP05850
Gene ID(2) 81614
Gene Symbol finder NIPA2
Protein Name non imprinted in Prader-Willi/Angelman syndrome 2
RefSeq NM_030922.5
Length of RefSeq (bp) 2588
Chromosome 15q11.2
Reference DDBJ accession
UniGene Hs.591003

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi26C11 pGCAP10 GTTTTCCTCGGCGCTTCTCCATGGAGGAGGCGGTGCGAACGGCTTCAGCCCCGAATGCTC
RBb26E05 pGCAP1 GGGTGCCGGAGGTTGTCCTTGGCAGGTTTTCCTCGGCGCTTCTCCATGGAGGAGGCGGTG
RBd64G02 pGCAP10 GGACGGCGGTGCCGGAGGTTGTCCTTGGCAGGTTTTCCTCGGCGCTTCTCCATGGAGGAG
RBdS040O08 pGCAP10 GGGCCCTAGGTCCCGGCAGCGGTGGTGACGGCGGTGCCGGAGGTTGTCCTTGGCAGGTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl