Prev. |  KEGG KO K22733 > 

RIKEN DNA Bank Human Resource - NIPA2

Gene ID NCBI Gene 81614 |  KEGG hsa:81614
Gene Symbol NIPA2
Protein Name NIPA magnesium transporter 2
Synonyms SLC57A2
Ortholog resource in our bank

  NIPA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001536 IRAK003N24 pCMV-SPORT6 BC000957 NM_030922 Partial
HGY090986 IRAL027H18 pOTB7 BC011775 NM_030922 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170459 ARi26C11 pGCAP10 NM_030922.5  
GTTTTCCTCGGCGCTTCTCCATGGAGGAGGCGGTGCGAACGGCTTCAGCCCCGAATGCTC
HKR330501 RBb26E05 pGCAP1 NM_030922.5  
GGGTGCCGGAGGTTGTCCTTGGCAGGTTTTCCTCGGCGCTTCTCCATGGAGGAGGCGGTG
HKR385746 RBd64G02 pGCAP10 NM_030922.5  
GGACGGCGGTGCCGGAGGTTGTCCTTGGCAGGTTTTCCTCGGCGCTTCTCCATGGAGGAG
HKR416344 RBdS040O08 pGCAP10 NM_030922.5  
GGGCCCTAGGTCCCGGCAGCGGTGGTGACGGCGGTGCCGGAGGTTGTCCTTGGCAGGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl