Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NIPA2

Gene ID (NCBI) 81614
Gene Symbol NIPA2
Protein Name non imprinted in Prader-Willi/Angelman syndrome 2
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001536 IRAK003N24 pCMV-SPORT6 BC000957 NM_030922 Partial
HGY090986 IRAL027H18 pOTB7 BC011775 NM_030922 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR170459 ARi26C11 pGCAP10 NM_030922.5
GTTTTCCTCGGCGCTTCTCCATGGAGGAGGCGGTGCGAACGGCTTCAGCCCCGAATGCTC
HKR330501 RBb26E05 pGCAP1 NM_030922.5
GGGTGCCGGAGGTTGTCCTTGGCAGGTTTTCCTCGGCGCTTCTCCATGGAGGAGGCGGTG
HKR385746 RBd64G02 pGCAP10 NM_030922.5
GGACGGCGGTGCCGGAGGTTGTCCTTGGCAGGTTTTCCTCGGCGCTTCTCCATGGAGGAG
HKR416344 RBdS040O08 pGCAP10 NM_030922.5
GGGCCCTAGGTCCCGGCAGCGGTGGTGACGGCGGTGCCGGAGGTTGTCCTTGGCAGGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl