Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05845

HP ID(1) HP05845
Gene ID(2) 51728
Gene Symbol finder POLR3K
Protein Name polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
RefSeq NM_016310.2
Length of RefSeq (bp) 796
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.632223

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150H10 pGCAP10 GGGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGA
RBb25F01 pGCAP1 GGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGATCGTGGAGGA
RBb32B10 pGCAP1 GGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGATCGTGGAGGAGG
RBb64C04 pGCAP1 AGTTGGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGC
RBd46A03 pGCAP10 GCTGCCCCGGCTGCGGGAACGGGCTGATCGTGGAGGAGGGACAACGCTGCCACCGCTTCG
RBdS013A15 pGCAP10 GGTTGGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGC
RBdS105B07 pGCAP10 GGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl