Prev. |  KEGG KO K03019 > 

RIKEN DNA Bank Human Resource - POLR3K

Gene ID NCBI Gene 51728 |  KEGG hsa:51728
Gene Symbol POLR3K
Protein Name RNA polymerase III subunit K
Synonyms C11|C11-RNP3|My010|RPC10|RPC11|RPC12.5
Ortholog resources KEGG ortholog (KEGG orthology K03019) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091473 IRAL028L09 pOTB7 BC011932 NM_016310 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE018827 W01A047B03 pENTR-TOPO IRAL028L09 BC011932 NM_016310  
HGE018829 W01A047B05 pENTR-TOPO IRAL028L09 BC011932 NM_016310  
HGE018833 W01A047B09 pENTR-TOPO IRAL028L09 BC011932 NM_016310  
HGE019158 W01A047O22 pENTR-TOPO IRAL028L09 BC011932 NM_016310  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR260178 ARiS150H10 pGCAP10 NM_016310.2  
GGGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGA
HKR330121 RBb25F01 pGCAP1 NM_016310.2  
GGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGATCGTGGAGGA
HKR332834 RBb32B10 pGCAP1 NM_016310.2  
GGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGATCGTGGAGGAGG
HKR345652 RBb64C04 pGCAP1 NM_016310.2  
AGTTGGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGC
HKR378403 RBd46A03 pGCAP10 NM_016310.2  
GCTGCCCCGGCTGCGGGAACGGGCTGATCGTGGAGGAGGGACAACGCTGCCACCGCTTCG
HKR405215 RBdS013A15 pGCAP10 NM_016310.2  
GGTTGGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGC
HKR442031 RBdS105B07 pGCAP10 NM_016310.2  
GGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl