Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05840

HP ID(1) HP05840
Gene ID(2) 23633
Gene Symbol finder KPNA6
Protein Name karyopherin alpha 6 (importin alpha 7)
RefSeq NM_012316.4
Length of RefSeq (bp) 7373
Chromosome 1p35.1-p34.3
Reference DDBJ accession
UniGene Hs.470588

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb25C02 pGCAP1 GGCCGTTGCCTCCGCCGCCAAGAGTGAGCGAGCGGACCCGCGATGGAGACCATGGCGAGC
RBd34F06 pGCAP10 AB621806 GATATATTGTCTACTGAAAGCTGCCGCTGAAGCTGCCGCCGTTGCCTTGAAGAGAAGAGT
RBd54D03 pGCAP10 TGGAAGCTGCCGCCGTTGCCTCCGCCGCCAAGAGTGAGCGAGCGGACCCGCGATGGAGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl