Prev. | 

RIKEN DNA Bank Human Resource - KPNA6

Gene ID NCBI Gene 23633 |  KEGG hsa:23633
Gene Symbol KPNA6
Protein Name karyopherin subunit alpha 6
Synonyms IPOA7|KPNA7
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009066 IRAK022L02 pCMV-SPORT6 BC020520 NM_012316 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR330050 RBb25C02 pGCAP1 NM_012316.4  
GGCCGTTGCCTCCGCCGCCAAGAGTGAGCGAGCGGACCCGCGATGGAGACCATGGCGAGC
HKR373726 RBd34F06 pGCAP10 NM_012316.4  
GATATATTGTCTACTGAAAGCTGCCGCTGAAGCTGCCGCCGTTGCCTTGAAGAGAAGAGT
HKR381675 RBd54D03 pGCAP10 NM_012316.4  
TGGAAGCTGCCGCCGTTGCCTCCGCCGCCAAGAGTGAGCGAGCGGACCCGCGATGGAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl