Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05836

HP ID(1) HP05836
Gene ID(2) 91942
Gene Symbol finder NDUFA12L
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2
RefSeq NM_174889.4
Length of RefSeq (bp) 719
Chromosome 5q12.1
Reference DDBJ accession
UniGene Hs.591757

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi50B08 pGCAP10 GGGGCTGGGTCGGCGGCTGGAGCATTACCCCTACTGCGGGTCCCGCTGCTGGCAGCGCTG
RBb24F10 pGCAP1 AGGATGGAGGCCGGCCTGACTTCTCCGCCTCGGTGGGCTGGGTCGGCGGCTGGAGCATTA
RBb27D02 pGCAP1 ATGGGTGGGCTGGGTCGGCGGCTGGAGCATTACCCCTACTGCGGGTCCCGCTGCTGGCAG
RBb60F04 pGCAP1 GACCCCTACTGCGGGTCCCGCTGCTGGCAGCGCTGGAAACTGGGTGGACGGCATGGGTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl