Prev. |  KEGG KO K18160 > 

RIKEN DNA Bank Human Resource - NDUFAF2

Gene ID NCBI Gene 91942 |  KEGG hsa:91942
Gene Symbol NDUFAF2
Protein Name NADH:ubiquinone oxidoreductase complex assembly factor 2
Synonyms B17.2L|MC1DN10|MMTN|NDUFA12L|mimitin
Ortholog resource in our bank

  NDUFAF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030487 IRAK076D15 pBluescriptR BC033965 NM_174889 Full
HGY082581 IRAL006H13 pOTB7 BC001753 NM_174889 Full
HGY103025 IRAL057J09 pDNR-LIB BC070357 NM_174889 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE120039 M01C100B15 pDONR221 IMS13-G08 BC033965 NM_174889  
HGE120087 M01C100D15 pDONR221 IMS13-G08 BC033965 NM_174889  
HGE120135 M01C100F15 pDONR221 IMS13-G08 BC033965 NM_174889  
HGE120183 M01C100H15 pDONR221 IMS13-G08 BC033965 NM_174889  
HGE120231 M01C100J15 pDONR221 IMS13-G08 BC033965 NM_174889  
HGE120279 M01C100L15 pDONR221 IMS13-G08 BC033965 NM_174889  
HGE120327 M01C100N15 pDONR221 IMS13-G08 BC033965 NM_174889  
HGE120375 M01C100P15 pDONR221 IMS13-G08 BC033965 NM_174889  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180032 ARi50B08 pGCAP10 NM_174889.4  
GGGGCTGGGTCGGCGGCTGGAGCATTACCCCTACTGCGGGTCCCGCTGCTGGCAGCGCTG
HKR329730 RBb24F10 pGCAP1 NM_174889.4  
AGGATGGAGGCCGGCCTGACTTCTCCGCCTCGGTGGGCTGGGTCGGCGGCTGGAGCATTA
HKR330874 RBb27D02 pGCAP1 NM_174889.4  
ATGGGTGGGCTGGGTCGGCGGCTGGAGCATTACCCCTACTGCGGGTCCCGCTGCTGGCAG
HKR344124 RBb60F04 pGCAP1 NM_174889.4  
GACCCCTACTGCGGGTCCCGCTGCTGGCAGCGCTGGAAACTGGGTGGACGGCATGGGTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl